Journal: International Journal of Molecular Sciences

Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells

doi: 10.3390/ijms17020197

Figure Lengend Snippet: Apobec-1 complementation factor (A1CF) is highly conserved among species. ( a ) A1CF amino acid sequences of human , mouse , rat , chicken , zebrafish , xenopus laevis were selected to analysis. The identical amino acids were shaded in black and the similar amino acids in grey; ( b ) Phylogenetic tree of A1CF amino acids is constructed using MEGA6 software, bootstrap percentages based on 1000 replicates, are shown on each branch. Identity values are listed on the right ranging from 78% to 92%, revealing that A1CF is highly conserved among species.

Article Snippet: SiRNA oligonucleotides were purchased from Shanghai GenePharma Co., Ltd. Two stealth siRNAs targeting different sequences of A1CF mRNA were selected to silence A1CF of Rattus norvegicus .

Techniques: Construct, Software

Journal: International Journal of Molecular Sciences

Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells

doi: 10.3390/ijms17020197

Figure Lengend Snippet: A1CF is expressed in mouse kidney starting at E15.5d and centers on the kidney tubules in C57BL/6 mice . ( a – c ) Whole mount in situ hybridization demonstrates that A1CF is expressed in the later stage of kidney development of C57BL/6 mice . White dot line indicates the area of metanephros rudiment (original magnification, ×40); ( c ′ ) To clearly prove the expression of A1CF, metanephros of embryonic day 15.5 (E15.5d) was detected with original magnification, ×100; ( d – g ) Section in situ hybridization demonstrates that in the adult mice kidney, A1CF is mainly expressed in the tubules of inner cortex but not in the other parts of the kidney section; ( d ) The black dot line marks the boundary between cortex and medulla. Scale bar represents 30 µm; ( e – g ) Images is the amplification of ( d ). ( e ) Scale bar represents 50 µm; ( f ) Image represents the field surrounding kidney tubules; Scale bar represents 100 µm; ( g ) Image represents the field of kidney tubules. Scale bar represents 100 µm; ( h , i ) In control groups no hybridization signal can be detected; ( h ) Scale bar represents 50 µm; ( i ) Scale bar represents 100 µm.

Article Snippet: SiRNA oligonucleotides were purchased from Shanghai GenePharma Co., Ltd. Two stealth siRNAs targeting different sequences of A1CF mRNA were selected to silence A1CF of Rattus norvegicus .

Techniques: In Situ Hybridization, Expressing, Amplification, Hybridization

Journal: International Journal of Molecular Sciences

Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells

doi: 10.3390/ijms17020197

Figure Lengend Snippet: Ectopic expression of A1CF inhibits EMT. ( a ) Overexpression A1CF and A1CF (-8AA) both result in gain of epithelial markers (E-cadherin) and loss of mesenchymal markers (vimentin and α-smooth muscle actin (α-SMA)), and the two variants have the similar trend in this process, GAPDH served as loading control; ( b ) Statistical analysis of relative protein expression levels. Data (mean ± standard error of the mean (S.E.M.)) are representative of three independent experiments. * p ≤ 0.05 and ** p ≤ 0.01 indicate significant statistical differences compared with the control group; ( c ) Immunofluorescence analysis demonstrates that ectopic expression of A1CF and A1CF (-8AA) potentiate the expression of membrane E-cadherin in NRK52e cells, and the expression of α-SMA and vimentin is weaker compared with control groups (original magnification, ×40). Scale bar represents 50 µm.

Article Snippet: SiRNA oligonucleotides were purchased from Shanghai GenePharma Co., Ltd. Two stealth siRNAs targeting different sequences of A1CF mRNA were selected to silence A1CF of Rattus norvegicus .

Techniques: Expressing, Over Expression, Immunofluorescence

Journal: International Journal of Molecular Sciences

Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells

doi: 10.3390/ijms17020197

Figure Lengend Snippet: A1CF knockdown induces EMT. ( a ) Control-siRNA, A1CF-siRNA #1, and A1CF-siRNA #2 were transfected into NRK52e cells. Western blotting analysis reveals a decrease in E-cadherin (epithelial marker) and concomitant increase in vimentin and α-SMA (mesenchymal markers). GAPDH served as loading control; ( b ) Statistical analysis of relative protein expression levels , Data (mean ± S.E.M.) are representative of three independent experiments. ** p ≤ 0.01 indicates highly statistically significant differences compared with control-siRNA group; ( c ) A1CF-siRNA #2 was transfected into NRK52e cells. A1CF knockdown attenuates the expression of membrane E-cadherin and potentiates the expression of α-SMA and vimentin demonstrated by immunofluorescence analysis (original magnification, ×40). Scale bar represents 50 µm.

Article Snippet: SiRNA oligonucleotides were purchased from Shanghai GenePharma Co., Ltd. Two stealth siRNAs targeting different sequences of A1CF mRNA were selected to silence A1CF of Rattus norvegicus .

Techniques: Transfection, Western Blot, Marker, Expressing, Immunofluorescence

Journal: International Journal of Molecular Sciences

Article Title: Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells

doi: 10.3390/ijms17020197

Figure Lengend Snippet: A1CF inhibits NRK52e cells migration. ( a ) Both A1CF and A1CF (-8AA) significantly inhibited NRK52e cells migration. Data were collected at 12 and 24 h (original magnification, ×100); ( c ) A1CF knockdown significantly increases NRK52e cells migration. Data were collected at 12 and 24 h (original magnification, ×100); ( b , d ) Data are presented as mean ± S.E.M. of three independent experiments. Statistical analysis was performed using Student’s t -test. ** p < 0.01 indicated significantly statistical differences compared with control groups.

Article Snippet: SiRNA oligonucleotides were purchased from Shanghai GenePharma Co., Ltd. Two stealth siRNAs targeting different sequences of A1CF mRNA were selected to silence A1CF of Rattus norvegicus .

Techniques: Migration

Journal: Science Advances

Article Title: A potent CBP/p300-Snail interaction inhibitor suppresses tumor growth and metastasis in wild-type p53-expressing cancer

doi: 10.1126/sciadv.aaw8500

Figure Lengend Snippet: ( A ) Immunoblot analysis of p53 expression in wild-type (left) and mutant (right) p53-expressing cells that were treated with vehicle or CYD19 for 48 hours. ( B ) Immunofluorescence staining of Snail and p53 in MMTV-PyMT (left) and HCT116 (right) cells treated with vehicle or 50 nM CYD19 for 48 hours. ( C ) Reverse transcription quantitative polymerase chain reaction (qPCR) analysis of p53 , p21 , and MDM2 expressions in MMTV-PyMT (top) and HCT116 (bottom) cells as described in (B). ( D ) Immunoblot analysis of p53, p21, and MDM2 expressions in MMTV-PyMT and HCT116 cells treated with vehicle or CYD19 for 48 hours. ( E ) Immunoblot analysis of p53 expression in MMTV-PyMT cells treated with vehicle or 50 nM CYD19 and then with CHX (100 μg/ml) for a total of 48 hours. ( F ) Densitometry of p53 protein in cells as described in (E). ( G ) Comparison of ubiquitinated p53 protein in vehicle- and CYD19-treated MMTV-PyMT cells. MG132 (10 μM) was added 4 hours before harvesting. Lysates from vehicle- and CYD19-treated cells loaded at ratios of 2:1 and 1:1 were subjected to IP assay using an anti-p53 antibody. ( H ) Comparison of acetylated p53 protein in vehicle- and CYD19-treated MMTV-PyMT cells as described in (G). ( I ) Comparison of binding interaction of p53 with HDAC1 in vehicle- and CYD19-treated MMTV-PyMT cells as described in (G). ( J ) Comparison of Snail, p53, and p21 expressions in control (left) and Snail-deleted (right) MMTV-PyMT cells that were treated with vehicle or CYD19 for 48 hours. All representative blots and images as shown are from three independent experiments. All data are presented as means ± SD ( n = 3 independent experiments). ** P < 0.01. Differences are tested using unpaired two-tailed Student’s t test (C).

Article Snippet: p3XFLAG-Snail-WT, p3XFLAG-Slug-WT, and pLKO.1-ms.p53-shRNA vectors were generated and used as described previously ( , ). pET23a(+)-His-Snail-WT, His-Snail-R174A, p3XFLAG-Snail-R174A, FLAG-Snail-K147R/K186R, pLKO.1-hu.p53-shRNA (targeting mRNA sequence from ATG, 176 to 196), pLKO.1-Snail-shRNA1 (468 to 486), pLKO.1-Snail-shRNA2 (1515 to 1533), pCDN3.1-GST-Snail-WT-GFP, and pCDN3.1-GST-Snail-R174A-GFP vectors were generated by GenScript Biotech Inc. (Nanjing, China).

Techniques: Western Blot, Expressing, Mutagenesis, Immunofluorescence, Staining, Reverse Transcription, Real-time Polymerase Chain Reaction, Comparison, Binding Assay, Control, Two Tailed Test

Journal: Science Advances

Article Title: A potent CBP/p300-Snail interaction inhibitor suppresses tumor growth and metastasis in wild-type p53-expressing cancer

doi: 10.1126/sciadv.aaw8500

Figure Lengend Snippet: ( A ) CCK-8 cell proliferation assay for wild-type and mutant p53-expressing cells treated with vehicle or CYD19 for 48 hours. ( B ) Quantification of apoptotic subpopulation in various cell lines treated with vehicle or CYD19 for 48 hours. ( C ) Immunoblot analysis of the indicated protein expressions in MMTV-PyMT (left) and HCT116 (right) cells as described in (B). C-casp9, cleaved caspase 9. ( D ) Immunoblot analysis of the indicated protein expressions in control and Snail-deleted MMTV-PyMT cells treated with vehicle or CYD19 for 48 hours. ( E ) CCK-8 analysis for control and Snail-deleted MMTV-PyMT cells treated with vehicle or CYD19 for 48 hours. ( F ) Quantification of apoptotic subpopulation in control and Snail-silenced HCT116 cells treated with vehicle or CYD19 for 48 hours. ( G ) CCK-8 analysis for control and Snail-silenced HCT116 cells treated with vehicle or CYD19 for 48 hours. ( H ) Quantification of apoptotic subpopulation in control and p53-silenced HCT116 cells treated with vehicle or CYD19 for 48 hours. ( I ) CCK-8 analysis for control and p53-silenced HCT116 cells treated with vehicle or CYD19 for 48 hours. ( J ) CCK-8 analysis for MMTV-PyMT and HCT116 cells that were treated with vehicle or taxol in combination with vehicle or 25 nM CYD19 for 48 hours. All representative blots as shown are from three independent experiments. All data are presented as means ± SD ( n = 3 independent experiments). ** P < 0.01. Differences are tested using one-way ANOVA with Tukey’s post hoc test (B, F, and H).

Article Snippet: p3XFLAG-Snail-WT, p3XFLAG-Slug-WT, and pLKO.1-ms.p53-shRNA vectors were generated and used as described previously ( , ). pET23a(+)-His-Snail-WT, His-Snail-R174A, p3XFLAG-Snail-R174A, FLAG-Snail-K147R/K186R, pLKO.1-hu.p53-shRNA (targeting mRNA sequence from ATG, 176 to 196), pLKO.1-Snail-shRNA1 (468 to 486), pLKO.1-Snail-shRNA2 (1515 to 1533), pCDN3.1-GST-Snail-WT-GFP, and pCDN3.1-GST-Snail-R174A-GFP vectors were generated by GenScript Biotech Inc. (Nanjing, China).

Techniques: CCK-8 Assay, Proliferation Assay, Mutagenesis, Expressing, Western Blot, Control

Journal: Science Advances

Article Title: A potent CBP/p300-Snail interaction inhibitor suppresses tumor growth and metastasis in wild-type p53-expressing cancer

doi: 10.1126/sciadv.aaw8500

Figure Lengend Snippet: ( A and B ) Primary tumor volumes (A) and weights (B) were measured in MMTV-PyMT mice that were intraperitoneally treated with vehicle or CYD19 (30 mg/kg) for 25 consecutive days ( n = 6 mice, each). ( C ) Immunohistochemical staining of Ki67 (top) and cleaved caspase 3 (bottom) in primary tumors of vehicle- and CYD19-treated mice ( n = 6 mice, each). ( D ) Quantification of Ki67-positive (Ki67 + ; top) and cleaved caspase 3–positive (C-casp3 + ; bottom) cells in tumors as described in (C). ( E ) Immunoblot analysis of Snail and p53 expressions in tumor lysates of vehicle- and CYD19-treated mice ( n = 3 pools from six mice, each). ( F ) Hematoxylin and eosin (H&E) staining for primary tumors as described in (C) ( n = 6 mice, each). Magnified areas of boxed sections are shown in the bottom panels. ( G ) Immunofluorescence staining of E-cadherin and vimentin in primary tumors as described in (C) ( n = 6 mice, each). ( H ) Quantification of staining intensity in primary tumors as described in (G). ( I and J ) Representative histogram (I) and quantification (J) of ALDH + subpopulation in primary tumors as described in (C) ( n = 6 mice, each). DEAB, diethylaminobenzaldehyde. ( K ) Immunofluorescence staining of F4/80 and CD31 in primary tumors as described in (C) ( n = 6 mice, each). ( L ) Quantification of staining intensity in primary tumors as described in (K). ( M ) H&E staining for vehicle- and CYD19-treated lungs ( n = 6 mice, each). ( N ) Magnified areas of boxed sections in (M) are shown. ( O ) Quantification of nodules in vehicle- and CYD19-treated lungs as described in (M). All data are presented as means ± SD ( n = 6 independent experiments). * P < 0.05 and ** P < 0.01. Differences are tested using Mann-Whitney U test.

Article Snippet: p3XFLAG-Snail-WT, p3XFLAG-Slug-WT, and pLKO.1-ms.p53-shRNA vectors were generated and used as described previously ( , ). pET23a(+)-His-Snail-WT, His-Snail-R174A, p3XFLAG-Snail-R174A, FLAG-Snail-K147R/K186R, pLKO.1-hu.p53-shRNA (targeting mRNA sequence from ATG, 176 to 196), pLKO.1-Snail-shRNA1 (468 to 486), pLKO.1-Snail-shRNA2 (1515 to 1533), pCDN3.1-GST-Snail-WT-GFP, and pCDN3.1-GST-Snail-R174A-GFP vectors were generated by GenScript Biotech Inc. (Nanjing, China).

Techniques: Immunohistochemical staining, Staining, Western Blot, Immunofluorescence, MANN-WHITNEY

Journal: Science Advances

Article Title: A potent CBP/p300-Snail interaction inhibitor suppresses tumor growth and metastasis in wild-type p53-expressing cancer

doi: 10.1126/sciadv.aaw8500

Figure Lengend Snippet: ( A and B ) HCT116 xenograft tumor volumes (A) and weights (B) were measured in athymic nude mice that were intraperitoneally treated with vehicle or CYD19 for two consecutive weeks ( n = 6 mice, each). ( C ) Immunohistochemical staining of Ki67 (top) and cleaved caspase 3 (bottom) in xenograft tumors of vehicle- and CYD19-treated mice ( n = 6 mice, each). ( D ) Quantification of Ki67 + (top) and C-casp3 + (bottom) cells in tumors as described in (C). ( E ) Immunoblot analysis of Snail and p53 expressions in tumor lysates of vehicle- and CYD19-treated mice ( n = 3 pools from six mice, each). ( F ) Immunofluorescence staining of E-cadherin and vimentin in xenograft tumors of vehicle- and CYD19-treated mice ( n = 6 mice, each). ( G ) Quantification of staining intensity in xenograft tumors as described in (F). ( H and I ) Representative histogram (H) and quantification (I) of ALDH + subpopulation in xenograft tumors as described in (C) ( n = 6 mice, each). ( J ) Growth of HCT116 xenograft tumors derived from 1 × 10 6 control cells or 2 × 10 6 Snail-silenced cells was monitored in nude mice treated with vehicle or CYD19 for two consecutive weeks ( n = 6 mice, each). ( K ) Immunoblot analysis of Snail and p53 expressions in lysates of xenograft tumors as described in (J). ( L ) Representative phase contrast (top), GFP fluorescence (middle), and H&E (bottom) images of vehicle- and CYD19-treated livers ( n = 6 mice, each). Mice were treated with vehicle or CYD19 for three consecutive weeks starting from the third day after surgery. ( M ) Quantification of fluorescence intensity in livers as described in (L). All data are presented as means ± SD ( n = 6 independent experiments). ** P < 0.01. Differences are tested using Mann-Whitney U test.

Article Snippet: p3XFLAG-Snail-WT, p3XFLAG-Slug-WT, and pLKO.1-ms.p53-shRNA vectors were generated and used as described previously ( , ). pET23a(+)-His-Snail-WT, His-Snail-R174A, p3XFLAG-Snail-R174A, FLAG-Snail-K147R/K186R, pLKO.1-hu.p53-shRNA (targeting mRNA sequence from ATG, 176 to 196), pLKO.1-Snail-shRNA1 (468 to 486), pLKO.1-Snail-shRNA2 (1515 to 1533), pCDN3.1-GST-Snail-WT-GFP, and pCDN3.1-GST-Snail-R174A-GFP vectors were generated by GenScript Biotech Inc. (Nanjing, China).

Techniques: Immunohistochemical staining, Staining, Western Blot, Immunofluorescence, Derivative Assay, Control, Fluorescence, MANN-WHITNEY

Journal: Cell death discovery

Article Title: USP39 regulates pyruvate handling in non-small cell lung cancer.

doi: 10.1038/s41420-024-02264-0

Figure Lengend Snippet: Fig. 4 USP39 is required for NSCLC tumor growth. A ATP levels upon 48 h of USP39 depletion measured by CE-TOF/MS (n = 3). B Cell growth of shRNA-expressing USP39 knockdown NCI-H1975 cell lines assessed over 72 h after induction with 20 ng/mL doxycycline for 48 h (n = 3). C Clonogenic assay with cells from (B), quantification in bar graph (n = 3). D Cell growth in A549 and NCI-H838 cells upon siRNA-mediated USP39 knockdown. E Clonogenic assay with cells from (D), quantification in bar graphs (n = 3). F Knockdown efficiency in xenograft tumors from doxycycline-inducible shRNA-expressing NCI-H1975 cells in mice (n = 6 per group). G Individual tumor growth of xenograft tumors from USP39-depleted cells measured over 17 days. Statistics were calculated from the averages of each group on day 17. H Final weight of tumors from (E). I Cell growth of NCI-H1975 cells upon siRNA-mediated USP39 knockdown with and without supplementation of 200 mM sodium citrate. Bar graphs show the cell counts after 72 h. Error bars ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ****p ≤0.0001.

Article Snippet: A plasmid with a non-targeting randomized shRNA sequence served as control (gift from Roland Friedel (Addgene plasmid # 98398; http://n2t.net/ addgene:98398; RRID:Addgene_98398) [55]).

Techniques: shRNA, Expressing, Knockdown, Clonogenic Assay

Journal: International Journal of Molecular Sciences

Article Title: Synovial CXCL3 + FOSL2 + Macrophages Mediate Inflammation via FOSL2 /AP-1 in Rheumatoid Arthritis: A Single-Cell Transcriptome Analysis

doi: 10.3390/ijms26199718

Figure Lengend Snippet: M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by shRNA- FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.

Article Snippet: Briefly, lentiviral vectors carrying shRNA targeting FOSL2 (targeted sequencing, 5′-GCAGTGAGTATTGGAAGACTT-3′) and a non-specific shRNA control (target sequencing, 5′-CCTAAGGTTAAGTCGCCCTCG-3′) were constructed and provided by OBiO Technology (Shanghai, China).

Techniques: In Vitro, Knockdown, Infection, shRNA, Control

Journal: Cell reports

Article Title: Histone H4K20 Demethylation by Two hHR23 Proteins.

doi: 10.1016/j.celrep.2020.03.001

Figure Lengend Snippet: Figure 3. UBA Domains Are Essential for the Demethylase Activity of hHR23A (A) Schematic representation of the domain structures of the WT and deletion mutants of hHR23A (left). The respective in vitro demethylation activities are listed on the right. (B) The 293T cells transfected with hHR23A and the deletion mutants were sorted and analyzed by immunoblotting using antibodies against FLAG, H4K20me1, and H4. (C) Coomassie blue staining of the purified GST fusion proteins. 1.5 mg of the purified proteins was loaded. (D and E) H4K20me1 substrate labeled by SETD8 (D) or H4K20me2/3 substrate labeled by Suv4-20h1 (E) was incubated with or without the GST-proteins, and the amounts of released [3H]-labeled formaldehyde were plotted (error bars, standard error of the mean [SEM]; n = 3; *p < 0.05 [Student’s t test]).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Flag-hHR23A, Flag-hHR23B, H4K20me1, H4K20me2 and H4K20me3 ChIP-seq in human HeLa cells This paper GEO: GSE135986 RNA-seq in human HeLa cells This paper GEO: GSE135988 The backbone chemical shift of hHR23A truncation This paper BMRB: 28007 Experimental Models: Cell Lines Human: HEK293T ATCC CRL-3216 Human: HeLa ATCC CCL-2 Oligonucleotides siRNA targeting SETD8 mRNA: AAUCGCCUAGGAAGACUGAUC This paper N/A shRNA1 targeting hHR23A mRNA: CCCTACCCTTATTCCATGAAA This paper N/A shRNA2 targeting hHR23A mRNA: AGGCCTATTTCGCGTGTGAAA This paper N/A shRNA1 targeting hHR23B mRNA: CCAGCGTTACTACAGCAGATA This paper N/A shRNA2 targeting hHR23B mRNA: CAGCAGATAGGTCGAGAGAAT This paper N/A Primers for ChIP- and qRT-PCR This paper See Tables S1–S3 Recombinant DNA Plasmid: pIRES2-Flag-hHR23A-EGFP This paper N/A Plasmid: pIRES2-Flag-hHR23B-EGFP This paper N/A Plasmid: pOZ-Flag-hHR23A This paper N/A Plasmid: pOZ-Flag-hHR23B This paper N/A Plasmid: pGEX-4T1-G9a This paper N/A Plasmid: pGEX-4T1-Set7 This paper N/A Plasmid: pGEX-4T1-SETD8 This paper N/A Plasmid: pGEX-6P1-Suv4-20h1 Schotta et al., 2004 N/A Plasmid: pGEX-6P1-Suv4-20h2 Schotta et al., 2004 N/A Software and Algorithms Bowtie Langmead et al., 2009 http://bowtie-bio.sourceforge.net/index. shtml MACS Zhang et al., 2008 https://github.com/taoliu/MACS GFOLD Feng et al., 2012 https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html MDDNMR Orekhov and Jaravine, 2011 http://mddnmr.spektrino.com/ NMRPipe Delaglio et al., 1995 https://www.ibbr.umd.edu/nmrpipe/install. html SPARKY T.D.

Techniques: Activity Assay, In Vitro, Transfection, Western Blot, Staining, Labeling, Incubation